Mature sequence cel-miR-1830-3p

Accession numberMIMAT0020778
IDcel-miR-1830-3p
Stem-Loop cel-mir-1830
Sequence
ccuaggaaaugagaaaacucggc
Get sequence
Deep sequencing4283 reads, 17 experiments
Database links
QuickGO function

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3