Mature sequence bdi-miR396e-5p

Accession numberMIMAT0020683
IDbdi-miR396e-5p
Stem-Loop bdi-MIR396e
Sequence
uuccacagcuuucuugaacuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).