Mature sequence hsa-miR-5095

Accession numberMIMAT0020600
IDhsa-miR-5095
Stem-Loop hsa-mir-5095
Sequence
uuacaggcgugaaccaccgcg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).