Mature sequence osa-miR5080

Accession numberMIMAT0020579
IDosa-miR5080
Stem-Loop osa-MIR5080
Sequence
aaaaggaucauaccgugacag
Get sequence
Deep sequencing4 reads, 2 experiments

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).