Mature sequence cel-miR-4923b

Accession numberMIMAT0020131
IDcel-miR-4923b
Stem-Loop cel-mir-4923b
Sequence
aacggcggcaauuuguuuacag
Get sequence
Deep sequencing68 reads, 11 experiments
Database links
QuickGO function

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).