Mature sequence cel-miR-4816-3p

Accession numberMIMAT0020006
IDcel-miR-4816-3p
Previous IDscel-miR-4816*
Stem-Loop cel-mir-4816
Sequence
aucuacaauuuucgcacuuacag
Get sequence
Deep sequencing2202 reads, 17 experiments
Database links
QuickGO function

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).