Mature sequence cel-miR-4815

Accession numberMIMAT0020004
IDcel-miR-4815
Stem-Loop cel-mir-4815
Sequence
uguaugagcaaaaugcgagga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).