Mature sequence cel-miR-4811-3p

Accession numberMIMAT0019997
IDcel-miR-4811-3p
Previous IDscel-miR-4811
Stem-Loop cel-mir-4811
Sequence
uauaacacucguauuguucgcu
Get sequence
Deep sequencing11 reads, 7 experiments

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).