Mature sequence hsa-miR-4773

• Accession number: MIMAT0019928
• ID: hsa-miR-4773
• Stem-Loop: hsa-mir-4773-1 hsa-mir-4773-2
• Sequence: cagaacaggagcauagaaaggc
• Deep sequencing: 41 reads, 12 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-4773
  • TargetScanVert:hsa-miR-4773
  • miRDB:hsa-miR-4773

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).