Mature sequence hsa-miR-4739

• Accession number: MIMAT0019868
• ID: hsa-miR-4739
• Stem-Loop: hsa-mir-4739
• Sequence: aagggaggaggagcggaggggcccu
• Deep sequencing: 75 reads, 40 experiments
• Database links:
  • RNAcentral:URS00002578DA_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4739
  • TargetScanVert:hsa-miR-4739
  • miRDB:hsa-miR-4739

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).