Mature sequence hsa-miR-4668-3p

• Accession number: MIMAT0019746
• ID: hsa-miR-4668-3p
• Stem-Loop: hsa-mir-4668
• Sequence: gaaaauccuuuuuguuuuuccag
• Deep sequencing: 26 reads, 23 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-4668-3p
  • TargetScanVert:hsa-miR-4668-3p
  • miRDB:hsa-miR-4668-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).