Mature sequence osa-miR2873b

Accession numberMIMAT0019685
IDosa-miR2873b
Stem-Loop osa-MIR2873b
Sequence
uuggacuugagauuugguaug
Get sequence
Deep sequencing183 reads, 2 experiments
Database links
QuickGO function

References

1