Mature sequence osa-miR3980b-5p

Accession numberMIMAT0019677
IDosa-miR3980b-5p
Stem-Loop osa-MIR3980b
Sequence
aaucgacggccucagucaggg
Get sequence
Deep sequencing174 reads, 2 experiments
Database links
QuickGO function

References

1