Mature sequence pma-miR-203a-3p

• Accession number: MIMAT0019512
• ID: pma-miR-203a-3p
• Previous IDs: pma-miR-203a
• Stem-Loop: pma-mir-203a
• Sequence: gugaaauguuuaggaccacugg
• Deep sequencing: reads, experiments

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).