Mature sequence pma-miR-124-5p

Accession numberMIMAT0019444
IDpma-miR-124-5p
Previous IDspma-miR-124*
Stem-Loop pma-mir-124
Sequence
cguguucacagcggaccuugau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).