Mature sequence hsa-miR-548an

Accession numberMIMAT0019079
IDhsa-miR-548an
Stem-Loop hsa-mir-548an
Sequence
aaaaggcauugugguuuuug
Get sequence
Deep sequencing750 reads, 58 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).