Mature sequence hsa-miR-548am-3p

Accession numberMIMAT0019076
IDhsa-miR-548am-3p
Previous IDshsa-miR-548am
Stem-Loop hsa-mir-548am
Sequence
caaaaacugcaguuacuuuugu
Get sequence
Deep sequencing3751 reads, 124 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).