Mature sequence hsa-miR-548al

Accession numberMIMAT0019024
IDhsa-miR-548al
Stem-Loop hsa-mir-548al
Sequence
aacggcaaugacuuuuguacca
Get sequence
Deep sequencing291 reads, 83 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).