Mature sequence hsa-miR-3689c

Accession numberMIMAT0019007
IDhsa-miR-3689c
Stem-Loop hsa-mir-3689c
Sequence
cugggaggugugauauuguggu
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).