Mature sequence hsa-miR-4435

Accession numberMIMAT0018951
IDhsa-miR-4435
Stem-Loop hsa-mir-4435-1 hsa-mir-4435-2
Sequence
auggccagagcucacacagagg
Get sequence
Deep sequencing490 reads, 27 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).