Mature sequence csi-miR396c

Accession numberMIMAT0018493
IDcsi-miR396c
Stem-Loop csi-MIR396c
Sequence
uucaagaaaucugugggaag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).