Mature sequence csi-miR396c

• Accession number: MIMAT0018493
• ID: csi-miR396c
• Stem-Loop: csi-MIR396c
• Sequence: uucaagaaaucugugggaag
• Deep sequencing: reads, experiments

References

1. PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).