Mature sequence csi-miR477c-5p

Accession numberMIMAT0018474
IDcsi-miR477c-5p
Stem-Loop csi-MIR477c
Sequence
acucucccucaagggcuucgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).