Mature sequence hsa-miR-548z

Accession numberMIMAT0018446
IDhsa-miR-548z
Stem-Loop hsa-mir-548z
Sequence
caaaaaccgcaauuacuuuugca
Get sequence
Deep sequencing6362 reads, 128 experiments
Database links
Predicted targets
QuickGO function

References

1