Mature sequence hsa-miR-642b-3p

Accession numberMIMAT0018444
IDhsa-miR-642b-3p
Previous IDshsa-miR-642b
Stem-Loop hsa-mir-642b
Sequence
agacacauuuggagagggaccc
Get sequence
Deep sequencing870 reads, 98 experiments
Database links
Predicted targets
QuickGO function

References

1