Mature sequence nlo-miR-10

Accession numberMIMAT0018416
IDnlo-miR-10
Stem-Loop nlo-mir-10
Sequence
acccuguagauccgaauuugu
Get sequence
Deep sequencing reads, experiments

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).