Mature sequence ngi-miR-100

Accession numberMIMAT0018402
IDngi-miR-100
Stem-Loop ngi-mir-100
Sequence
uacccguagauccgacuguggg
Get sequence
Deep sequencing reads, experiments

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).