Mature sequence ngi-miR-1

Accession numberMIMAT0018385
IDngi-miR-1
Stem-Loop ngi-mir-1
Sequence
uggaauguaaagaaguauggag
Get sequence
Deep sequencing reads, experiments

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).