Mature sequence gma-miR4413a

Accession numberMIMAT0018338
IDgma-miR4413a
Previous IDsgma-miR4413
Stem-Loop gma-MIR4413a
Sequence
aagagaauuguaagucacug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2