Mature sequence gma-miR4406

Accession numberMIMAT0018325
IDgma-miR4406
Stem-Loop gma-MIR4406
Sequence
auugauucugagagaaccggugua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2