Mature sequence gma-miR4401a

Accession numberMIMAT0018319
IDgma-miR4401a
Previous IDsgma-miR4401
Stem-Loop gma-MIR4401a
Sequence
acaacgucuuugaaaguaggcauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2