Mature sequence gma-miR4399

Accession numberMIMAT0018315
IDgma-miR4399
Stem-Loop gma-MIR4399
Sequence
uuaacgaaaaaggacuaacgac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).