Mature sequence gma-miR4374b

Accession numberMIMAT0018282
IDgma-miR4374b
Stem-Loop gma-MIR4374b
Sequence
uacuuucaaagacguuguugag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).