Mature sequence gma-miR4369

Accession numberMIMAT0018270
IDgma-miR4369
Stem-Loop gma-MIR4369
Sequence
ggaucaagcugauccggaagugga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).