Mature sequence gma-miR1520f-3p

Accession numberMIMAT0018244
IDgma-miR1520f-3p
Previous IDsgma-miR1520f
Stem-Loop gma-MIR1520f
Sequence
caaucagaacaugacacaugacaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2