Mature sequence gma-miR4341

Accession numberMIMAT0018229
IDgma-miR4341
Stem-Loop gma-MIR4341
Sequence
uguguugaaaguuuaacaugacgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).