Mature sequence hvu-miR156a

Accession numberMIMAT0018207
IDhvu-miR156a
Previous IDshvu-miR156
Stem-Loop hvu-MIR156a
Sequence
ugacagaagagagugagcaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).