Mature sequence hsa-miR-3908

Accession numberMIMAT0018182
IDhsa-miR-3908
Stem-Loop hsa-mir-3908
Sequence
gagcaauguagguagacuguuu
Get sequence
Deep sequencing25 reads, 11 experiments
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).