Mature sequence hsa-miR-3689b-3p

Accession numberMIMAT0018181
IDhsa-miR-3689b-3p
Previous IDshsa-miR-3689b*
Stem-Loop hsa-mir-3689b
Sequence
cugggaggugugauauuguggu
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).