Mature sequence hsa-miR-3689b-5p

Accession numberMIMAT0018180
IDhsa-miR-3689b-5p
Previous IDshsa-miR-3689b
Stem-Loop hsa-mir-3689b
Sequence
ugugauaucaugguuccuggga
Get sequence
Deep sequencing124 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).