Mature sequence hsa-miR-3680-5p

Accession numberMIMAT0018106
IDhsa-miR-3680-5p
Previous IDshsa-miR-3680
Stem-Loop hsa-mir-3680-1 hsa-mir-3680-2
Sequence
gacucacucacaggauugugca
Get sequence
Deep sequencing178 reads, 37 experiments
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).