Mature sequence hsa-miR-3666

• Accession number: MIMAT0018088
• ID: hsa-miR-3666
• Stem-Loop: hsa-mir-3666
• Sequence: cagugcaaguguagaugccga
• Deep sequencing: reads, experiments
• Predicted targets:
  • TargetMiner:hsa-miR-3666
  • TargetScanVert:hsa-miR-3666
  • miRDB:hsa-miR-3666

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:20559549 "Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment" Smith B, Treadwell J, Zhang D, Ly D, McKinnell I, Walker PR, Sikorska M PLoS One. 5:e11109(2010).