Mature sequence hsa-miR-3662

Accession numberMIMAT0018083
IDhsa-miR-3662
Stem-Loop hsa-mir-3662
Sequence
gaaaaugaugaguagugacugaug
Get sequence
Deep sequencing804 reads, 37 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).