Mature sequence vvi-miR3634-3p

Accession numberMIMAT0018040
IDvvi-miR3634-3p
Previous IDsvvi-miR3634
Stem-Loop vvi-MIR3634
Sequence
uuuccgacucgcacucaugccgu
Get sequence
Deep sequencing1222 reads, 2 experiments

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).