Mature sequence vvi-miR3627-5p

Accession numberMIMAT0018017
IDvvi-miR3627-5p
Previous IDsvvi-miR3627
Stem-Loop vvi-MIR3627
Sequence
uugucgcaggagagacggcacu
Get sequence
Deep sequencing2 reads, 1 experiments

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).