Mature sequence hsa-miR-3615

Accession numberMIMAT0017994
IDhsa-miR-3615
Stem-Loop hsa-mir-3615
Sequence
ucucucggcuccucgcggcuc
Get sequence
Deep sequencing6244 reads, 126 experiments
Database links
Predicted targets
QuickGO function

References

1