Mature sequence hsa-miR-3609

Accession numberMIMAT0017986
IDhsa-miR-3609
Stem-Loop hsa-mir-3609
Sequence
caaagugaugaguaauacuggcug
Get sequence
Deep sequencing2420 reads, 134 experiments
Database links
Predicted targets
QuickGO function

References

1