Mature sequence ssc-miR-487b

Accession numberMIMAT0017973
IDssc-miR-487b
Stem-Loop ssc-mir-487b
Sequence
gugguuaucccuguccuguucg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).