Mature sequence ssc-miR-4332

Accession numberMIMAT0017962
IDssc-miR-4332
Stem-Loop ssc-mir-4332
Sequence
cacggccgccgccgggcgcc
Get sequence
Deep sequencing264 reads, 11 experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).