Mature sequence ath-miR774b-3p

Accession numberMIMAT0017740
IDath-miR774b-3p
Previous IDsath-miR774b*
Stem-Loop ath-MIR774b
Sequence
cauccauauuuucaucucgaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).