Mature sequence aly-miR838-3p

Accession numberMIMAT0017622
IDaly-miR838-3p
Previous IDsaly-miR838
Stem-Loop aly-MIR838
Sequence
uuuucuucuucuucuugcaca
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).